The never ending chat thread, chat about anything That your up too

[cany]

yes had a nice talk ?with the general ,, stay well my friend!!,,,,,,,,,,,,,,, ><))):>
><))):>

mojoe my BRO ??

 

[MOJOE]

mojoe my BRO ??

always brother ?,,,,,,,,,,,,,,,,,,,,,,,,, ><))):>
><))):>

 

[MOJOE]

also had a great talk? with nyangler george the boss,,,,,,,,,,,,stay well george and barbra,,,,talk soon,,,,,,,, ><))):>
><))):>

 

[cany]

Siting here in pain this sucks I can barely walk

 

[cany]

Chatting with gaucho might of found a Harley for him

 

[Roccus7]

Just got back in from undoing a "Dom, that was a F-ing STUPID move!!!" Of course during today's undoing, I did a bunch of other STUPID things too...

• After doing my tree transplanting yesterday I ventured into a very boggy area of the lawn, I should have known damn well that is was too soft after doing this at least twice over the past 10 springs. Well I got stuck and trying to get her out only made it worse. Decided I'd deal with it today so I went inside.
  
  
• Went outside this AM armed with a bottle jack and pieces of wood, although the "Little Voice", you know, The Admiral, said, "Why don't you just bring the truck around?" I was concerned that with my luck I'd get the truck stuck too so I screwed around with the jack and plywood for about 3 hours and proceeded to make it worse.
  
  
• Went and got the truck, but her in 4WD LOW and VOILA, she was free. I hate it when The Admiral is right, but she was this time, OY!!!
  
  
• Took me another 30 min to wash all the mud off of everything.

 

[cany]

Just got back in from undoing a "Dom, that was a F-ing STUPID move!!!" Of course during today's undoing, I did a bunch of other STUPID things too...

• After doing my tree transplanting yesterday I ventured into a very boggy area of the lawn, I should have known damn well that is was too soft after doing this at least twice over the past 10 springs. Well I got stuck and trying to get her out only made it worse. Decided I'd deal with it today so I went inside.
  
  
• Went outside this AM armed with a bottle jack and pieces of wood, although the "Little Voice", you know, The Admiral, said, "Why don't you just bring the truck around?" I was concerned that with my luck I'd get the truck stuck too so I screwed around with the jack and plywood for about 3 hours and proceeded to make it worse.
  
  
• Went and got the truck, but her in 4WD LOW and VOILA, she was free. I hate it when The Admiral is right, but she was this time, OY!!!
  
  
• Took me another 30 min to wash all the mud off of everything.

What did you get stuck?

 

[Roccus7]

What did you get stuck?

My Zero Turn Lawn Mower. Was using it as a tractor to pull a dump cart full of trees, but got mired down heading back to the shed. The wheel spinning in the mud bottom her out, always a fun time!!

 

[cany]

My Zero Turn Lawn Mower. Was using it as a tractor to pull a dump cart full of trees, but got mired down heading back to the shed. The wheel spinning in the mud bottom her out, always a fun time!!

LOL get a small tractor

 

[Roccus7]

LOL get a small tractor

Same difference, tractor would have gotten stuck too, and it won't work for cutting my grass. Lots of trees and rocks to avoid so I need the Zero Turn. It wasn't an equipment issue, just Operator Error...

 

[cany]

Same difference, tractor would have gotten stuck too, and it won't work for cutting my grass. Lots of trees and rocks to avoid so I need the Zero Turn. It wasn't an equipment issue, just Operator Error...

My Lil wheel horse tractor dont get stuck lol

 

[cany]

Eating dinner with Jenn we dont do this much lately Im never home for dinner

 

[MOJOE]

Eating dinner with Jenn we dont do this much lately Im never home for dinner

general and jenn ,,,, enjoy ,, jenn your dinner looks killer ,, have a good nite,,,,,,,,,,,, ><))):>
><))):>

 

[cany]

general and jenn ,,,, enjoy ,, jenn your dinner looks killer ,, have a good nite,,,,,,,,,,,, ><))):>
><))):>

It was Delishhhhhhh

 

[cany]

getting ready for a nap dinner made me sleepy

 

[MOJOE]

getting ready for a nap dinner made me sleepy

???,,,,,,,,,,,,,, ,,,,,,,, ><))):>
><))):>

 

[cany]

Filing up the Keurig Its that time

 

[Roccus7]

My Lil wheel horse tractor dont get stuck lol

View attachment 17918

Wish I had LI sand and not Maine Marine Clay. This time of year I can lose a boot in my yard if I'm not careful. Trust me, Lil Wheel would be spinning. Ask Mud about Mud here,

 

[cany]

Wish I had LI sand and not Maine Marine Clay. This time of year I can lose a boot in my yard if I'm not careful. Trust me, Lil Wheel would be spinning. Ask Mud about Mud here,

Lil wheel had a hard life in upstate mud and streams shes even plowed snow with no issues Shes no Lawn mower lol

 

[Roccus7]

Trying to lower my blood pressure. Show on COVID-19 was talking about the viral RNA sequence and they put up the amino acid sequence of a protein. Tossed a few harmless items at the TV.

Getting very tired of the blind, leading the blind. Why show a "sequence" when a "representation" of the RNA would be fine.

It's so easy to tell the difference, took me 3 nanoseconds, there's only 4 different letters in an RNA sequence, A, U, G, & C. Same goes for DNA except the U is replaced by a T. 20 letters used for Proteins: A, R, N, D, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, & V

RNA Sequence: AUGGAGAGCCUUGUCCUGGUUUC

Protein AA Sequence: SNLKPFERDISTEIYQAGSTP

No the RNA above is NOT the RNA that would make that peptide, wasn't in the mood to grab a biochem text to make sure I got it correctly. I've lost my fluency in transcription and codons.