The never ending chat thread, chat about anything That your up too

also had a great talk? with nyangler george the boss(y),,,,,,,,,,,,stay well george and barbra,,,,talk soon,,,,,,,, ><))):>
><))):>
 
Just got back in from undoing a "Dom, that was a F-ing STUPID move!!!" Of course during today's undoing, I did a bunch of other STUPID things too...
  • After doing my tree transplanting yesterday I ventured into a very boggy area of the lawn, I should have known damn well that is was too soft after doing this at least twice over the past 10 springs. Well I got stuck and trying to get her out only made it worse. Decided I'd deal with it today so I went inside.

  • Went outside this AM armed with a bottle jack and pieces of wood, although the "Little Voice", you know, The Admiral, said, "Why don't you just bring the truck around?" I was concerned that with my luck I'd get the truck stuck too so I screwed around with the jack and plywood for about 3 hours and proceeded to make it worse.

  • Went and got the truck, but her in 4WD LOW and VOILA, she was free. I hate it when The Admiral is right, but she was this time, OY!!!

  • Took me another 30 min to wash all the mud off of everything.
 
Just got back in from undoing a "Dom, that was a F-ing STUPID move!!!" Of course during today's undoing, I did a bunch of other STUPID things too...
  • After doing my tree transplanting yesterday I ventured into a very boggy area of the lawn, I should have known damn well that is was too soft after doing this at least twice over the past 10 springs. Well I got stuck and trying to get her out only made it worse. Decided I'd deal with it today so I went inside.

  • Went outside this AM armed with a bottle jack and pieces of wood, although the "Little Voice", you know, The Admiral, said, "Why don't you just bring the truck around?" I was concerned that with my luck I'd get the truck stuck too so I screwed around with the jack and plywood for about 3 hours and proceeded to make it worse.

  • Went and got the truck, but her in 4WD LOW and VOILA, she was free. I hate it when The Admiral is right, but she was this time, OY!!!

  • Took me another 30 min to wash all the mud off of everything.
What did you get stuck?
 
Same difference, tractor would have gotten stuck too, and it won't work for cutting my grass. Lots of trees and rocks to avoid so I need the Zero Turn. It wasn't an equipment issue, just Operator Error...
My Lil wheel horse tractor dont get stuck lol

wheelhorse.webp
 
Wish I had LI sand and not Maine Marine Clay. This time of year I can lose a boot in my yard if I'm not careful. Trust me, Lil Wheel would be spinning. Ask Mud about Mud here, ;););)
Lil wheel had a hard life in upstate mud and streams shes even plowed snow with no issues Shes no Lawn mower lol
 
Trying to lower my blood pressure. Show on COVID-19 was talking about the viral RNA sequence and they put up the amino acid sequence of a protein. Tossed a few harmless items at the TV.

Getting very tired of the blind, leading the blind. Why show a "sequence" when a "representation" of the RNA would be fine.

It's so easy to tell the difference, took me 3 nanoseconds, there's only 4 different letters in an RNA sequence, A, U, G, & C. Same goes for DNA except the U is replaced by a T. 20 letters used for Proteins: A, R, N, D, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, & V

RNA Sequence: AUGGAGAGCCUUGUCCUGGUUUC

Protein AA Sequence: SNLKPFERDISTEIYQAGSTP

No the RNA above is NOT the RNA that would make that peptide, wasn't in the mood to grab a biochem text to make sure I got it correctly. I've lost my fluency in transcription and codons.
 

Members online

Fishing Reports

Latest articles

Back
Top