The never ending chat thread, chat about anything That your up too

[cany]

Trying to lower my blood pressure. Show on COVID-19 was talking about the viral RNA sequence and they put up the amino acid sequence of a protein. Tossed a few harmless items at the TV.

Getting very tired of the blind, leading the blind. Why show a "sequence" when a "representation" of the RNA would be fine.

It's so easy to tell the difference, took me 3 nanoseconds, there's only 4 different letters in an RNA sequence, A, U, G, & C. Same goes for DNA except the U is replaced by a T. 20 letters used for Proteins: A, R, N, D, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, & V

RNA Sequence: AUGGAGAGCCUUGUCCUGGUUUC

Protein AA Sequence: SNLKPFERDISTEIYQAGSTP

No the RNA above is NOT the RNA that would make that peptide, wasn't in the mood to grab a biochem text to make sure I got it correctly. I've lost my fluency in transcription and codons.

What

 

[Roccus7]

What

OK, let's change the context. How would you react if there was a TV News story on a factory recall of a power brake pump and they showed a rotor?? Kind of what went on here...

 

[cany]

OK, let's change the context. How would you react if there was a TV News story on a factory recall of a power brake pump and they showed a rotor?? Kind of what went on here...

ok now I get it ? ?

 

[cany]

I must be stupid my sciatica is killing me I can barely walk yet Im here at work WTF is wrong with me

 

[live bait]

Loyal. Hope the boss treats you as good as you treat him.
John

 

[cany]

Loyal. Hope the boss treats you as good as you treat him.
John

He does

 

[live bait]

Guess you answered your own question, that's why you showed up today. Stay safe.
John

 

[cany]

Home early should of left earlier like everyone was telling me to do what a hell day couldnt walk spent mot of my time rolling around in a chair under cars

 

[JackPrintMD]

Hows the Back?

Any better?

 

[cany]

Hows the Back?

Any better?

I cant walk without being in pain

 

[CELLFISH]

my back killing me, I bought a bike yesterday from pawn shop, $65.00, brand new models sold out... cellie...

.

 

[cany]

my back killing me, I bought a bike yesterday from pawn shop, $65.00, brand new models sold out... cellie...

.
View attachment 17963

Jeesh C22 get a new seat would ya

 

[CELLFISH]

Jeesh C22 get a new seat would ya

all gyms are locked down, bicycles are all sold out, this includes Bike Seats... cellie... ?

 

[cany]

Watching youtube for sciatica stretches

 

[CELLFISH]

Watching youtube for sciatica stretches

bet it’s the left leg... cellie...

.

 

[Tigashrk]

bet it’s the left leg... cellie...

.

Cell my girl bought this!

 

[Roccus7]

Just spent the better part of the evening deciphering the new system Instagram just launched to prevent downloading pictures from there. Well, they can try to fool me, but I've always loved challenges. Mission accomplished!!

 

[cany]

Just got up Im staying home today Im still in pain

 

[JackPrintMD]

Just got up Im staying home today Im still in pain

Take it easy General, glad you can stay home and rest your back.

Hope you feel better soon.

The only thing that helps me when my back goes out is stretching in the hot shower and 20 minute intervals of cold ice pack then heating pad with a half hour break in between, for a few hours.

Sucks.

 

[cany]

Take it easy General, glad you can stay home and rest your back.

Hope you feel better soon.

The only thing that helps me when my back goes out is stretching in the hot shower and 20 minute intervals of cold ice pack then heating pad with a half hour break in between, for a few hours.

Sucks.

Jenns getting a heating pad today I cant find the one I had